SNRP70 (SNRNP70) (NM_003089) Human 3' UTR Clone

CAT#: SC202009

3`UTR clone of small nuclear ribonucleoprotein 70kDa (U1) (SNRNP70) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SNRNP70
• Synonyms: RNPU1Z; RPU1; Snp1; SNRP70; U1-70K; U1AP; U1RNP; U170K
• ACCN: NM_003089
• Insert Size: 199 bp
• Sequence Data:
  Insert Sequence

  >SC202009 3'UTR clone of NM_003089
  The sequence shown below is from the reference sequence of NM_003089. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGGTATTTGATGGAGGCTGCGCCGGAGTGAAGAGGTCGTCCTCTCCATCTGCTGTGTTTGGACGCGTTCC
  TGCCCAGCCCCTTGCTGTCATCCCCTCCCCCAACCTTGGCCACTTGAGTTTGTCCTCCAAGGGTAGGTGT
  CTCATTTGTTCTGGCCCCTTGGATTTAAAAATAAAATTAATTTCCTGTTGATAGTGGGC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003089.4
• Summary: ''
• Locus ID: 6625