Cyclophilin E (PPIE) (NM_203456) Human 3' UTR Clone

CAT#: SC202043

3`UTR clone of peptidylprolyl isomerase E (cyclophilin E) (PPIE) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PPIE"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PPIE
Synonyms CYP-33; CYP33
ACCN NM_203456
Insert Size 187
Sequence Data
>SC202043 3'UTR clone of NM_203456
The sequence shown below is from the reference sequence of NM_203456. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGTCAGCAATTACCAGCCAGCCGAGGTCCTGGAAGCTGACGTAGAGCTCGTGCCGACGGCAGACCTGCC
GGCCGTGGGAGCCGTGGACGTCATCTGCAGGGACAGAAGGGGCAAGGTCTTTTCTGGGGTTCCTACTGTG
TGCAGCTACTATGGGGTACCAGGGTGGGGGATGCCCTGATGAGCACA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_203456.1
Summary The protein encoded by this gene is a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. This protein contains a highly conserved cyclophilin (CYP) domain as well as an RNA-binding domain. It was shown to possess PPIase and protein folding activities, and it also exhibits RNA-binding activity. Alternative splicing results in multiple transcript variants. A related pseudogene, which is also located on chromosome 1, has been identified. [provided by RefSeq, Aug 2010]
Locus ID 10450

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.