Prostaglandin D Synthase (PTGDS) (NM_000954) Human 3' UTR Clone

CAT#: SC202050

3`UTR clone of prostaglandin D2 synthase 21kDa (brain) (PTGDS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTGDS
• Synonyms: L-PGDS; LPGDS; PDS; PGD2; PGDS; PGDS2
• ACCN: NM_000954
• Insert Size: 161 bp
• Sequence Data:
  Insert Sequence

  >SC202050 3'UTR clone of NM_000954
  The sequence shown below is from the reference sequence of NM_000954. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCGATAAGTGCATGACGGAACAATAGGACTCCCCAGGGCTGAAGCTGGGATCCCGGCCAGCCAGGTGACC
  CCCACGCTCTGGATGTCTCTGCTCTGTTCCTTCCCCGAGCCCCTGCCCCGGCTCCCCGCCAAAGCAACCC
  TGCCCACTCAGGCTTCATCCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000954.5
• Summary: 'The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]'
• Locus ID: 5730