PRPF8 (NM_006445) Human 3' UTR Clone

CAT#: SC202054

3`UTR clone of PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) (PRPF8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PRPF8
• Synonyms: HPRP8; PRP8; PRPC8; RP13; SNRNP220
• ACCN: NM_006445
• Insert Size: 184
• Sequence Data:
  Insert Sequence

  >SC202054 3'UTR clone of NM_006445
  The sequence shown below is from the reference sequence of NM_006445. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGGTTTACTCTGCGGATCGGGAGGACCTGTATGCCTGACCGTTTCCCTGCCTCCTGCTTCAGCCTCCC
  GAGGCCGAAGCCTCAGCCCCTCCAGACAGGCCGCTGACATTCAGCAGTTTGGCCTCTTTCCCTCTGTCTG
  TGCTTGTGTTGTTGACCTCCTGATGGCTTGTCATCCTGAATAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006445.3
• Summary: Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
• Locus ID: 10594