SF3B14 (SF3B6) (NM_016047) Human 3' UTR Clone

CAT#: SC202065

3`UTR clone of splicing factor 3B 14 kDa subunit (SF3B14) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SF3B6
• Synonyms: CGI-110; HSPC175; Ht006; P14; SAP14; SAP14a; SF3B14; SF3B14a
• ACCN: NM_016047
• Insert Size: 204
• Sequence Data:
  Insert Sequence

  >SC202065 3'UTR clone of NM_016047
  The sequence shown below is from the reference sequence of NM_016047. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCATCAACACAGATCCACCAAAATAAATGTTTTCTACATTTTCATTTGGACTAAATCCCACGAATGACA
  ACTACCACCTTTTTTTCCTTTTTAATTAATACTAAATATTGTGATTTCTTATTTGAGGTTCAAAATGACC
  TGCTTGAAACTTTGATACATATTGGAATACATTATGTTAATAAACTTGTAGCTTTTTGTGAAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016047.3
• Summary: This gene encodes a 14 kDa protein subunit of the splicing factor 3b complex. Splicing factor 3b associates with both the U2 and U11/U12 small nuclear ribonucleoprotein complexes (U2 snRNP) of spliceosomes. This 14 kDa protein interacts directly with subunit 1 of the splicing factor 3b complex. This 14 kDa protein also interacts directly with the adenosine that carries out the first transesterification step of splicing at the pre-mRNA branch site. [provided by RefSeq, Jul 2008]
• Locus ID: 51639