COX5A (NM_004255) Human 3' UTR Clone

CAT#: SC202072

3`UTR clone of cytochrome c oxidase subunit Va (COX5A) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COX5A
• Synonyms: COX; COX-VA; VA
• ACCN: NM_004255
• Insert Size: 192
• Sequence Data:
  Insert Sequence

  >SC202072 3'UTR clone of NM_004255
  The sequence shown below is from the reference sequence of NM_004255. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTGGGAATCTCCACTCCGGAGGAACTGGGCCTTGACAAAGTGTAAACCGCATGGATGGGCTTCCCCAAG
  GATTTATTGACATTGCTACTTGAGTGTGAACAGTTACCTGGAAATACTGATGATAACATATTACCTTATT
  TGAACAAGTTTTCCTTTATTGAGTACCAAGCCATGTAATGGTAACTTGGACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004255.3
• Summary: Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer of proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Va of the human mitochondrial respiratory chain enzyme. A pseudogene COX5AP1 has been found in chromosome 14q22. [provided by RefSeq, Jul 2008]
• Locus ID: 9377