CTAGE5 (MIA2) (NM_054024) Human 3' UTR Clone

CAT#: SC202079

3`UTR clone of melanoma inhibitory activity 2 (MIA2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MIA2
• Synonyms: CTAGE5; MEA6; MGEA; MGEA6; MGEA11; TALI
• ACCN: NM_054024
• Insert Size: 142 bp
• Sequence Data:
  Insert Sequence

  >SC202079 3'UTR clone of NM_054024
  The sequence shown below is from the reference sequence of NM_054024. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTATTTTGCTAAATATAAGAGTGGCTACAAAATATGTTTGAATGAATCCTCCCTGTTTAATGTTTATATA
  ATGTTTCTCTTTCCATGACATCTTACCTGTAAGATTTCTCTTTATATGAATGTTTTGTCAAATGGATATT
  GA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_054024.3
• Summary: 'This gene encodes s receptor in the endoplasmic reticulum, which plays a role in the export of large pre-chylomicrons and pre-very low density lipoproteins (pre-VLDLs). Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species (TANGO1-like or TALI). Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Sep 2016]'
• Locus ID: 4253