Somatostatin (SST) (NM_001048) Human 3' UTR Clone

CAT#: SC202083

3`UTR clone of somatostatin (SST) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SST
• Synonyms: SMST
• ACCN: NM_001048
• Insert Size: 183 bp
• Sequence Data:
  Insert Sequence

  >SC202083 3'UTR clone of NM_001048
  The sequence shown below is from the reference sequence of NM_001048. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTGGAAGACTTTCACATCCTGTTAGCTTTCTTAACTAGTATTGTCCATATCAGACCTCTGATCCCTCGC
  CCCCACACCCCATCTCTCTTCCCTAATCCTCCAAGTCTTCAGCGAGACCCTTGCATTAGAAACTGAAAAC
  TGTAAATACAAAATAAAATTATGGTGAAATTATGAAAAATGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001048.3
• Summary: 'The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]'
• Locus ID: 6750