Cyclin H (CCNH) (NM_001239) Human 3' UTR Clone

CAT#: SC202107

3`UTR clone of cyclin H (CCNH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCNH
• Synonyms: CAK; CycH; p34; p37
• ACCN: NM_001239
• Insert Size: 215 bp
• Sequence Data:
  Insert Sequence

  >SC202107 3'UTR clone of NM_001239
  The sequence shown below is from the reference sequence of NM_001239. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAATGGACTGATGACGACCTGGTAGAATCTCTCTAACCATTTGAAGTTGATTTCTCAATGCTAACTAATC
  AAGAGAAGTAGGAAGCATATCAAACGTTTAACTTTATTTAAAAAGTATAATGTGAAAACATAAAATATAT
  TAAAACTTTTCTATTGTTTTCTTTCCCTTTCACAGTAACTTTATGTAAAATAAACCATCTTCAAAAGAGC
  TAGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001239.2
• Summary: 'The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010]'
• Locus ID: 902