Cardiac Troponin T (TNNT2) (NM_001001431) Human 3' UTR Clone

CAT#: SC202145

3`UTR clone of troponin T type 2 (cardiac) (TNNT2) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TNNT2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TNNT2
Synonyms CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
ACCN NM_001001431
Insert Size 207 bp
Sequence Data
>SC202145 3'UTR clone of NM_001001431
The sequence shown below is from the reference sequence of NM_001001431. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGGAAGGCTAAAGTCACCGGGCGCTGGAAATAGAGCCTGGCCTCCTTCACCAAAGATCTGCTCCTCGCTC
GCACCTGCCTCCGGCCTGCACTCCCCCAGTTCCCGGGCCCTCCTGGGCACCCCAGGCAGCTCCTGTTTGG
AAATGGGGAGCTGGCCTAGGTGGGAGCCACCACTCCTGCCTGCCCCCACACCCACTCCACACCAGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001001431.1
Summary 'The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]'
Locus ID 7139

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.