COL8A1 (NM_020351) Human 3' UTR Clone

CAT#: SC202154

3`UTR clone of collagen type VIII alpha 1 (COL8A1) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "COL8A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol COL8A1
Synonyms C3orf7
ACCN NM_020351
Insert Size 220 bp
Sequence Data
>SC202154 3'UTR clone of NM_020351
The sequence shown below is from the reference sequence of NM_020351. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTCCACTCCTCCTTTTCAGGATATTTATTGTATCCCATGTAAAAACAAAAAAACAAAAAACAAAGAAAAG
AAAGAGATTTTATAGAAGAAAATGACACACCAAAAAATCCAAATGAAAAACATAATTGCTTCAAAACACT
TACACAGTTGGAAAGTTATATGTAAGTGAAAATTTGGACCATTGTGTACAAATAAAAACTAAGATGCATG
TTTAATACTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_020351.2
Summary 'This gene encodes one of the two alpha chains of type VIII collagen. The gene product is a short chain collagen and a major component of the basement membrane of the corneal endothelium. The type VIII collagen fibril can be either a homo- or a heterotrimer. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Dec 2011]'
Locus ID 1295

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.