alpha 1a Adrenergic Receptor (ADRA1A) (NM_033304) Human 3' UTR Clone

CAT#: SC202163

3`UTR clone of adrenergic alpha-1A- receptor (ADRA1A) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADRA1A
• Synonyms: ADRA1C; ADRA1L1; ALPHA1AAR
• ACCN: NM_033304
• Insert Size: 217 bp
• Sequence Data:
  Insert Sequence

  >SC202163 3'UTR clone of NM_033304
  The sequence shown below is from the reference sequence of NM_033304. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGCCACCGTGGAGAAAGGGTTCAGAATGCTGATCTCCAGGTAGCTGGAGACCTAGGCAGTCTGCAAATG
  AGGAGTCAGCTGGAAGCTATGGCTATGTATTATGTGACATCGCTTGTTCCTAAGTGAAAACTGGATATCC
  CAACCTTCTGGCCCAGTAGGTTTCATGGTTAAGACCTGGTAGTGAGAACATTTTAGGAACTATTTGCTTG
  GGCAGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033304.2
• Summary: 'Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1A-adrenergic receptor. Alternative splicing of this gene generates four transcript variants, which encode four different isoforms with distinct C-termini but having similar ligand binding properties. [provided by RefSeq, Jul 2008]'
• Locus ID: 148