CD98 (SLC3A2) (NM_001012664) Human 3' UTR Clone

CAT#: SC202208

3`UTR clone of solute carrier family 3 (activators of dibasic and neutral amino acid transport) member 2 (SLC3A2) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SLC3A2
• Synonyms: 4F2; 4F2HC; 4T2HC; CD98; CD98HC; MDU1; NACAE
• ACCN: NM_001012664
• Insert Size: 221
• Sequence Data:
  Insert Sequence

  >SC202208 3'UTR clone of NM_001012664
  The sequence shown below is from the reference sequence of NM_001012664. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGCCTCACGAAGGGCTGCTGCTCCGCTTCCCCTACGCGGCCTGACTTCAGCCTGACATGGACCCACT
  ACCCTTCTCCTTTCCTTCCCAGGCCCTTTGGCTTCTGATTTTTCTCTTTTTTAAAAACAAACAAACAAAC
  TGTTGCAGATTATGAGTGAACCCCCAAATAGGGTGTTTTCTGCCTTCAAATAAAAGTCACCCCTGCATGG
  TGAAGTCTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001012664.1
• Summary: This gene is a member of the solute carrier family and encodes a cell surface, transmembrane protein. The protein exists as the heavy chain of a heterodimer, covalently bound through di-sulfide bonds to one of several possible light chains. The encoded transporter plays a role in regulation of intracellular calcium levels and transports L-type amino acids. Alternatively spliced transcript variants, encoding different isoforms, have been characterized. [provided by RefSeq, Nov 2010]
• Locus ID: 6520