CD98 (SLC3A2) (NM_001012662) Human 3' UTR Clone

CAT#: SC202211

3`UTR clone of solute carrier family 3 (activators of dibasic and neutral amino acid transport) member 2 (SLC3A2) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC3A2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SLC3A2
Synonyms 4F2; 4F2HC; 4T2HC; CD98; CD98HC; MDU1; NACAE
ACCN NM_001012662
Insert Size 221
Sequence Data
>SC202211 3'UTR clone of NM_001012662
The sequence shown below is from the reference sequence of NM_001012662. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGAGCCTCACGAAGGGCTGCTGCTCCGCTTCCCCTACGCGGCCTGACTTCAGCCTGACATGGACCCACT
ACCCTTCTCCTTTCCTTCCCAGGCCCTTTGGCTTCTGATTTTTCTCTTTTTTAAAAACAAACAAACAAAC
TGTTGCAGATTATGAGTGAACCCCCAAATAGGGTGTTTTCTGCCTTCAAATAAAAGTCACCCCTGCATGG
TGAAGTCTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001012662.1
Summary This gene is a member of the solute carrier family and encodes a cell surface, transmembrane protein. The protein exists as the heavy chain of a heterodimer, covalently bound through di-sulfide bonds to one of several possible light chains. The encoded transporter plays a role in regulation of intracellular calcium levels and transports L-type amino acids. Alternatively spliced transcript variants, encoding different isoforms, have been characterized. [provided by RefSeq, Nov 2010]
Locus ID 6520

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.