Slingshot homolog 1 (SSH1) (NM_001161330) Human 3' UTR Clone

CAT#: SC202257

3`UTR clone of slingshot homolog 1 (Drosophila) (SSH1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SSH1
• Synonyms: SSH1L
• ACCN: NM_001161330
• Insert Size: 202
• Sequence Data:
  Insert Sequence

  >SC202257 3'UTR clone of NM_001161330
  The sequence shown below is from the reference sequence of NM_001161330. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGGGTTCTTTCACAGGGTGATTCTGCTGGTGGGTACGTAGTGCATACCTTATATAGCAAATTGAGAAT
  CTGTTGGGAATAACACATATCTCTGCACACCATCTTCACCCCATGTACCTTATTCATACCCTGGGCAGGG
  CTTCCAACTCAATTTCTTTTTGTGTATGTAAAATTAAAACATATAATTTATCAGCCAACTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001161330.1
• Summary: The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
• Locus ID: 54434