ACADVL (NM_001033859) Human 3' UTR Clone

CAT#: SC202267

3`UTR clone of acyl-Coenzyme A dehydrogenase very long chain (ACADVL) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ACADVL"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ACADVL
Synonyms ACAD6; LCACD; VLCAD
ACCN NM_001033859
Insert Size 160 bp
Sequence Data
>SC202267 3'UTR clone of NM_001033859
The sequence shown below is from the reference sequence of NM_001033859. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCCCTCAAGCCAAAG
CCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGCACTGTGCCTGCTC
TCAAGAGCACTTACTGCCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001033859.1
Summary The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 37

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.