ALG3 (NM_001006941) Human 3' UTR Clone

CAT#: SC202275

3`UTR clone of asparagine-linked glycosylation 3 alpha-13- mannosyltransferase homolog (S. cerevisiae) (ALG3) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALG3
• Synonyms: CDG1D; CDGS4; CDGS6; D16Ertd36e; not; Not56; NOT56L
• ACCN: NM_001006941
• Insert Size: 189
• Sequence Data:
  Insert Sequence

  >SC202275 3'UTR clone of NM_001006941
  The sequence shown below is from the reference sequence of NM_001006941. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAACACAGCAAGAAAGCCCACTGAAGTCCACCCCTTTCCCTCAGGACCTGAGTCTACCCTCAGGACCTGG
  GGTTGGTTGGACTCTGCCCTTCCAAATAAACCTTGCTAAGTCCAACTCTGTGCAACCTACATGGAGGTGG
  GGGCAGCCGATGCCTGGTCCAGGCTGTGAGGGACACGTATGGAGCAGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001006941.2
• Summary: This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
• Locus ID: 10195