DAXX (NM_001141970) Human 3' UTR Clone

CAT#: SC202280

3`UTR clone of death-domain associated protein (DAXX) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DAXX
• Synonyms: BING2; DAP6; EAP1; SMIM40
• ACCN: NM_001141970
• Insert Size: 210 bp
• Sequence Data:
  Insert Sequence

  >SC202280 3'UTR clone of NM_001141970
  The sequence shown below is from the reference sequence of NM_001141970. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCATCGTGCTCTCAGACTCTGATTAGCTGCCTCCCCTTCTCCCTGCCTCCAGAATGTTCTGGGATAACAT
  TTGGAGGAAGGTGGGAAGCAGATGACTGAGGAAGGGATGGACTAAGCTAATCCCCTTTTGGTGGTGTTTC
  TTTAAAAAAAAAAAAAAGCTTAAGTTTTACACAGAAACATTAATAAACAATAAAGTTCTTTTCTTACTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001141970.1
• Summary: 'This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]'
• Locus ID: 1616