DAXX (NM_001350) Human 3' UTR Clone

CAT#: SC202281

3`UTR clone of death-domain associated protein (DAXX) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAXX"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DAXX
Synonyms BING2; DAP6; EAP1; SMIM40
ACCN NM_001350
Insert Size 210 bp
Sequence Data
>SC202281 3'UTR clone of NM_001350
The sequence shown below is from the reference sequence of NM_001350. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCATCGTGCTCTCAGACTCTGATTAGCTGCCTCCCCTTCTCCCTGCCTCCAGAATGTTCTGGGATAACAT
TTGGAGGAAGGTGGGAAGCAGATGACTGAGGAAGGGATGGACTAAGCTAATCCCCTTTTGGTGGTGTTTC
TTTAAAAAAAAAAAAAAGCTTAAGTTTTACACAGAAACATTAATAAACAATAAAGTTCTTTTCTTACTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001350.4
Summary 'This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]'
Locus ID 1616

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.