TTC37 (NM_014639) Human 3' UTR Clone

CAT#: SC202288

3`UTR clone of tetratricopeptide repeat domain 37 (TTC37) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TTC37
• Synonyms: KIAA0372; Ski3; THES
• ACCN: NM_014639
• Insert Size: 216
• Sequence Data:
  Insert Sequence

  >SC202288 3'UTR clone of NM_014639
  The sequence shown below is from the reference sequence of NM_014639. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGCATTGGAACTGAATCAGAGATTGTCCTCACAATAACATTGGATTATTTTATAGTAAGGAAGCAAAGA
  AAAAGCTGTAAGAATGAAGCAATGAATCAAGACTTCTACCCAAAGCAACATTTTTTTAAACTATATTTAT
  TCCTTTTCTAAAGGAATCTAGAGAAGTTGAAGTTTTTAAGTTAGGAATGCAATTTTCTGTTAACTCCAAA
  CCTGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014639.2
• Summary: This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
• Locus ID: 9652