DNA Ligase I (LIG1) (NM_000234) Human 3' UTR Clone

CAT#: SC202304

3`UTR clone of ligase I DNA ATP-dependent (LIG1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LIG1
• ACCN: NM_000234
• Insert Size: 224 bp
• Sequence Data:
  Insert Sequence

  >SC202304 3'UTR clone of NM_000234
  The sequence shown below is from the reference sequence of NM_000234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCAACAAGGCGAGGACTCAGGCTCTGACCCTGAAGATACCTACTAAGCCCTCGCCCTCCTAGGGCCTGG
  GTACAGGGCATGAGTTGGACGGACCCCAGGGTTATTATTGCCTTTGCTTTTTAGCAAATCTGCTGTGGCA
  GGCTGTGGATTTTGAGAGTCAGGGGAGGGGTGTGTGTGTGAGGGGGTGGCTTACTCCGGAGTCTGGGATT
  CATCCCGTCATTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000234.1
• Summary: 'This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
• Locus ID: 3978