Muscarinic Acetylcholine Receptor M3 (CHRM3) (NM_000740) Human 3' UTR Clone

CAT#: SC202331

3`UTR clone of cholinergic receptor muscarinic 3 (CHRM3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CHRM3
• Synonyms: EGBRS; HM3; PBS
• ACCN: NM_000740
• Insert Size: 231 bp
• Sequence Data:
  Insert Sequence

  >SC202331 3'UTR clone of NM_000740
  The sequence shown below is from the reference sequence of NM_000740. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGTCATTTTTCACAAGCGCGCACCCGAGCAGGCCTTGTAGAATGAGGTTGTATCAATAGCAGTGACAAA
  ACGCACACATCAACCCACAGACCTTAGGAGGAGGAAGGCGAGGGCGGGGTGACTTCTGGTGATGATAAAA
  ATGGTTTTATCACCCAGATGTGAAAGAAGCTGCCTGTTTACTGATCCATTGAATAAACCCATTTTAATAG
  AAAAAGTCAATACCAATTCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000740.2
• Summary: 'The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]'
• Locus ID: 1131