Fatty Acid Binding Protein 5 (FABP5) (NM_001444) Human 3' UTR Clone

CAT#: SC202335

3`UTR clone of fatty acid binding protein 5 (psoriasis-associated) (FABP5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FABP5
• Synonyms: E-FABP; EFABP; KFABP; PA-FABP; PAFABP
• ACCN: NM_001444
• Insert Size: 225 bp
• Sequence Data:
  Insert Sequence

  >SC202335 3'UTR clone of NM_001444
  The sequence shown below is from the reference sequence of NM_001444. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAATGTCACCTGTACTCGGATCTATGAAAAAGTAGAATAAAAATTCCATCATCACTTTGGACAGGAGTTA
  ATTAAGAGAATGACCAAGCTCAGTTCAATGAGCAAATCTCCATACTGTTTCTTTCTTTTTTTTTTCATTA
  CTGTGTTCAATTATCTTTATCATAAACATTTTACATGCAGCTATTTCAAAGTGTGTTGGATTAATTAGGA
  TCATCCCTTTGGTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001444.1
• Summary: 'This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011]'
• Locus ID: 2171