SHKBP1 (NM_138392) Human 3' UTR Clone

CAT#: SC202338

3`UTR clone of SH3KBP1 binding protein 1 (SHKBP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SHKBP1
• Synonyms: PP203; Sb1
• ACCN: NM_138392
• Insert Size: 207
• Sequence Data:
  Insert Sequence

  >SC202338 3'UTR clone of NM_138392
  The sequence shown below is from the reference sequence of NM_138392. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCACACCTCCCAAGATGAAGCTCAATGAAACTTCCTTTTGAACAACGCAGCTGCCATGATGCCTTGGG
  ATGCCCTGGTCCTGGGGGACTCAGGTGCCTCCCTGATTCCTGTGGGAACCCCGGGTTCAGGGCCAGGGCC
  TCCTTGGAATAAATGGTTATTGTTACTAGGTCCCCACCTTCCCTCTTTTCTGGAAGCCAAAGTCACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_138392.3
• Locus ID: 92799