CARD9 (NM_052814) Human 3' UTR Clone

CAT#: SC202345

3`UTR clone of caspase recruitment domain family member 9 (CARD9) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CARD9"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CARD9
Synonyms CANDF2; hCARD9
ACCN NM_052814
Insert Size 179
Sequence Data
>SC202345 3'UTR clone of NM_052814
The sequence shown below is from the reference sequence of NM_052814. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGCATTGGGGCCGTTTGTTAAGCGGCACTCATTTTGCGGAGGCCATGCGGGTGCTCACCACCCCCATGCA
CACGCCATCTGTGTAACTTCAGGATCTGTTCTGTTTCACCATGTAACACACAATACATGCATGCATTGTA
TTAGTGTTAGAAAACACAGCTGCGTAAATAAACAGCACG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_052814.3
Summary The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
Locus ID 64170

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.