GRHPR (NM_012203) Human 3' UTR Clone

CAT#: SC202349

3`UTR clone of glyoxylate reductase/hydroxypyruvate reductase (GRHPR) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRHPR
• Synonyms: GLXR; GLYD; PH2
• ACCN: NM_012203
• Insert Size: 201
• Sequence Data:
  Insert Sequence

  >SC202349 3'UTR clone of NM_012203
  The sequence shown below is from the reference sequence of NM_012203. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTAGTGAACTCAAGCTGTAGCCAAACAGTAGAGATGGAGGGCCGGGAAGCAAACCGTGCCCTGGTATT
  GTCAGACACACCCAGGCTTGATTTGGATCCACAGGCAGAGCCAAGGGAAGGTGTGATTCTCTGAGGAAAG
  AGTGATTCTGATATATGTACTTGTCACATTGGTGTTGGACACATTTGCGCCAAAAGTATGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012203.1
• Summary: This gene encodes an enzyme with hydroxypyruvate reductase, glyoxylate reductase, and D-glycerate dehydrogenase enzymatic activities. The enzyme has widespread tissue expression and has a role in metabolism. Type II hyperoxaluria is caused by mutations in this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 9380