LCMT1 (NM_016309) Human 3' UTR Clone

CAT#: SC202410

3`UTR clone of leucine carboxyl methyltransferase 1 (LCMT1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LCMT1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LCMT1
Synonyms CGI-68; LCMT; PPMT1
ACCN NM_016309
Insert Size 243
Sequence Data
>SC202410 3'UTR clone of NM_016309
The sequence shown below is from the reference sequence of NM_016309. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAATGAGCTTGGGCTGAAGGAGATAACTTATTAATCTGTCGAAGGCTTATGCCGAGCCAGAAGCCGAA
GCCACTTGCCCTCCTGGAGGAGACCTGCAAGCTCCCTGAGCGGTGGGCGGGCCTCGTCCGCAGGTCTCAT
CCCACACTCTTGAGAAGCCTTGGTCACTACAGTGGTCGCACATGTTCCTCTTCCTGTTCCTGTTGACATG
TCGTTGTTTAAATAAATCTCACTTGCCACCAGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016309.2
Summary LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]). [supplied by OMIM, Mar 2008]
Locus ID 51451

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.