ZNRD1 (NM_170783) Human 3' UTR Clone

CAT#: SC202427

3`UTR clone of zinc ribbon domain containing 1 (ZNRD1) transcript variant a for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ZNRD1
• Synonyms: HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZR14
• ACCN: NM_170783
• Insert Size: 215
• Sequence Data:
  Insert Sequence

  >SC202427 3'UTR clone of NM_170783
  The sequence shown below is from the reference sequence of NM_170783. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAAGTTCCAGGAGAAGGAAGACTCTTGACCTTTTTCCTGGGCAACTCTACAGTCCCTCCCTCCTTTCGG
  AAGGTGAAGGATACTGGGTTTTTAGATGCCTTGTCCATCCTGTCTGGTTGCAATGTTTTGCTCCCAGAAG
  AGAATCAGATCATCATGTGGGGATTACCATTGTTCCTGGAGTACTCCTACCCTTAGTTGAATTTCCTTAT
  TAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_170783.2
• Summary: This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
• Locus ID: 30834