GMPPA (NM_013335) Human 3' UTR Clone

CAT#: SC202430

3`UTR clone of GDP-mannose pyrophosphorylase A (GMPPA) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GMPPA
• Synonyms: AAMR
• ACCN: NM_013335
• Insert Size: 206
• Sequence Data:
  Insert Sequence

  >SC202430 3'UTR clone of NM_013335
  The sequence shown below is from the reference sequence of NM_013335. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTTCACCAACCAGATCATCCTCTGAGTAGGGCTGCCAGAAGGCCCCCAGCTCCTACCCACTCCCCTTGA
  GGCTGCTGCCTGCTTGGCCAGCCTCTGTCCAGAAAGGACCAGAGAAAGCCAGGCTGGATCGTCACATGCC
  GGGGAGCAATGTGGATGGCCTGGGGACTCCTGGGTTTTCTCCCTCCCGACTCCCTAATAAACCCCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013335.2
• Summary: This gene is thought to encode a GDP-mannose pyrophosphorylase. This enzyme catalyzes the reaction which converts mannose-1-phosphate and GTP to GDP-mannose which is involved in the production of N-linked oligosaccharides. [provided by RefSeq, Jul 2008]
• Locus ID: 29926