UQCRHL (NM_001089591) Human 3' UTR Clone

CAT#: SC202437

3`UTR clone of ubiquinol-cytochrome c reductase hinge protein-like (UQCRHL) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UQCRHL
• ACCN: NM_001089591
• Insert Size: 232
• Sequence Data:
  Insert Sequence

  >SC202437 3'UTR clone of NM_001089591
  The sequence shown below is from the reference sequence of NM_001089591. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAAGGACCATTGCGTGGCCCACAAACTCTTTAACAACTTGAAATAAATGTGTGGACTTAATTCACCCCA
  GCCTTCATCATCTGGGCATCAGAATATTTCCTTATGGTTTCGGATGTACCATTTGTTTCTTATTTGTGTA
  ACTGTAAGTTCACATGAACCTCGTGGGTTTTGGCTTAGGCTGGTAGCTTCTATGTAATTCGCAGTGATTC
  CATCTAAATAAAAGTTCTGTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001089591.1
• Summary: This gene has characteristics of a pseudogene derived from the UQCRH gene. However, there is still an open reading frame that could produce a protein of the same or nearly the same size as that of the UQCRH gene, so this gene is being called protein-coding for now. [provided by RefSeq, Jul 2008]
• Locus ID: 440567