PHPT1 (NM_014172) Human 3' UTR Clone

CAT#: SC202457

3`UTR clone of phosphohistidine phosphatase 1 (PHPT1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PHPT1
• Synonyms: CGI-202; HEL-S-132P; HSPC141; PHP; PHP14
• ACCN: NM_014172
• Insert Size: 189
• Sequence Data:
  Insert Sequence

  >SC202457 3'UTR clone of NM_014172
  The sequence shown below is from the reference sequence of NM_014172. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTAACGACGGCTACTGAGCACTCCCAGCCCGGGGCCTGCTGCCTCCAGCAGCCACTTCAGAGCCCCCGC
  CTTTGCCTGCACTCCTCTTGCAGGGCTGGCCCTGCCTGCTCCTGCGGCAGCCTCTGGTGACGTGCTGTCC
  ACCAGGCCTTGGAGACAGGCTAGCCTGGCCACAGAATTAAACGTGTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014172.4
• Summary: This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta and ATP citrate lyase and in negatively regulating CD4 T lymphocytes by dephosphorylation and inhibition of KCa3.1 channels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
• Locus ID: 29085