CYC1 (NM_001916) Human 3' UTR Clone

CAT#: SC202468

3`UTR clone of cytochrome c-1 (CYC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYC1
• Synonyms: MC3DN6; UQCR4
• ACCN: NM_001916
• Insert Size: 208 bp
• Sequence Data:
  Insert Sequence

  >SC202468 3'UTR clone of NM_001916
  The sequence shown below is from the reference sequence of NM_001916. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAGTCCTGAAGAGTCGGAAGCTGGCATATCGGCCGCCCAAGTGACCCTGTCCAGTGTCTGCTTGCCATC
  CTGCCAGAACAGGCCCTCAAGCCCAAGAGCCATCCCAGGCCTGTTCAGGCCTCAGCTAAGCCTCTCTTCA
  TCTGGAAGAAGAGGCAAGGGGGCAGGAGACCAGGCTCTAGCTCTGGGCCCTCCTTCAGCCCCCATCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001916.3
• Summary: 'This gene encodes a subunit of the cytochrome bc1 complex, which plays an important role in the mitochondrial respiratory chain by transferring electrons from the Rieske iron-sulfur protein to cytochrome c. Mutations in this gene may cause mitochondrial complex III deficiency, nuclear type 6. [provided by RefSeq, Dec 2013]'
• Locus ID: 1537