ASPM (NM_018136) Human 3' UTR Clone

CAT#: SC202486

3`UTR clone of asp (abnormal spindle) homolog microcephaly associated (Drosophila) (ASPM) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ASPM"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ASPM
Synonyms ASP; Calmbp1; MCPH5
ACCN NM_018136
Insert Size 222
Sequence Data
>SC202486 3'UTR clone of NM_018136
The sequence shown below is from the reference sequence of NM_018136. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGGTGATGGATACGCTTGGCATTCCTTATTAGTAAATGTAAACATTTTCAGTATGTATAGTGTAAAGAAA
TATTAAAGCCAATCATGAGTACGTAAAGTGATTTTTGCTCTCCGTGTACAACTTTTAAAATCTGACTTTG
TTTTAAAAAAACATAAACTGTTCATTACATTCTTCATTTTTATCATTTATAGTTTTATGCATGTAATAAA
CTAATATGTCAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018136.4
Summary This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Locus ID 259266

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.