PLAAT4 (NM_004585) Human 3' UTR Clone

CAT#: SC202500

3`UTR clone of retinoic acid receptor responder (tazarotene induced) 3 (RARRES3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLAAT4
• Synonyms: HRASLS4; HRSL4; PLA1/2-3; PLAAT-4; RARRES3; RIG1; TIG3
• ACCN: NM_004585
• Insert Size: 236 bp
• Sequence Data:
  Insert Sequence

  >SC202500 3'UTR clone of NM_004585
  The sequence shown below is from the reference sequence of NM_004585. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGCTCTTTTGCGATTAGGAGATACCAAAAAAAAGCGACAGCCTGAAGCAGCCACAAAATCCTGTGTTA
  GAAGCAGCTGTGGGGGTCCCAGTGGAGATGAGCCTCCCCCATGCCTCCAGCAGCCTGACCCTCGTGCCCT
  GTCTCAGGCGTTCTCTAGATCCTTTCCTCTGTTTCCCTCTCTCGCTGGCAAAAGTATGATCTAATTGAAA
  CAAGACTGAAGGATCAATAAACAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004585.3
• Summary: 'Retinoids exert biologic effects such as potent growth inhibitory and cell differentiation activities and are used in the treatment of hyperproliferative dermatological diseases. These effects are mediated by specific nuclear receptor proteins that are members of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. RARRES1, RARRES2, and RARRES3 are genes whose expression is upregulated by the synthetic retinoid tazarotene. RARRES3 is thought act as a tumor suppressor or growth regulator. [provided by RefSeq, Jul 2008]'
• Locus ID: 5920