SIPA1 (NM_153253) Human 3' UTR Clone

CAT#: SC202529

3`UTR clone of signal-induced proliferation-associated 1 (SIPA1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SIPA1
• Synonyms: SPA1
• ACCN: NM_153253
• Insert Size: 222 bp
• Sequence Data:
  Insert Sequence

  >SC202529 3'UTR clone of NM_153253
  The sequence shown below is from the reference sequence of NM_153253. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCAAGCAGCTGGGCTCACCCACCGCCGACCTGGCCTGAGCCGTCTGGAACCACCTGGGCCCCTGAGGGC
  ACTGTGGTCACACTGGGCCCTCCTCAGGAACTCTCCCTGCGCAGAGGCGTGTCTTAGCACTGCCCCCCTC
  CCTAGCCCCTTATTTGGTGGCGGAAGTGGCCTCCACCCCTTCCCTGTTTGTAAATATTCTGTGGAGAAAA
  GAGGACTTCAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_153253.29
• Summary: 'The product of this gene is a mitogen induced GTPase activating protein (GAP). It exhibits a specific GAP activity for Ras-related regulatory proteins Rap1 and Rap2, but not for Ran or other small GTPases. This protein may also hamper mitogen-induced cell cycle progression when abnormally or prematurely expressed. It is localized to the perinuclear region. Two alternatively spliced variants encoding the same isoform have been characterized to date. [provided by RefSeq, Jul 2008]'
• Locus ID: 6494