HAGH (NM_005326) Human 3' UTR Clone

CAT#: SC202540

3`UTR clone of hydroxyacylglutathione hydrolase (HAGH) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HAGH
• Synonyms: GLO2; GLX2; GLXII; HAGH1
• ACCN: NM_005326
• Insert Size: 186
• Sequence Data:
  Insert Sequence

  >SC202540 3'UTR clone of NM_005326
  The sequence shown below is from the reference sequence of NM_005326. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGACCAGTTCAAGATGCCCCGGGACTGAGGCCGCCCTGCACCTTCAGCGGATTTGGGGATTAGGCTCTT
  TTAGGTAACTGGCTTTCCTGCTGGTCCGTGCGGGAAATTCAGTCTTGATTTAACCTTAATTTTACAGCCC
  TTGGCTTGTGTTATCGGACATTCTAATGCATATTTATAAGAGAAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005326.4
• Summary: The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
• Locus ID: 3029