FES (NM_001143785) Human 3' UTR Clone

CAT#: SC202552

3`UTR clone of feline sarcoma oncogene (FES) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FES
• Synonyms: FPS
• ACCN: NM_001143785
• Insert Size: 250 bp
• Sequence Data:
  Insert Sequence

  >SC202552 3'UTR clone of NM_001143785
  The sequence shown below is from the reference sequence of NM_001143785. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCTACCAGGAGCTGCAGAGCATCCGAAAGCGGCATCGGTGAGGCTGGGACCCCCTTCTCAAGCTGGTG
  GCCTCTGCAGGCCTAGGTGCAGCTCCTCAGCGGCTCCAGCTCATATGCTGACAGCTCTTCACAGTCCTGG
  ACTCCTGCCACCAGCATCCACACTGCCGGCAGGATGCAGCGCCGTGTCCTCTCTGTGTCCCTGCTGCTGC
  CAGGGCTTCCTCTTCCGGGCAGAAACAATAAAACCACTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001143785.1
• Summary: 'This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]'
• Locus ID: 2242