HPD (NM_002150) Human 3' UTR Clone

CAT#: SC202553

3`UTR clone of 4-hydroxyphenylpyruvate dioxygenase (HPD) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HPD
• Synonyms: 4-HPPD; 4HPPD; GLOD3; HPPDASE; PPD
• ACCN: NM_002150
• Insert Size: 236 bp
• Sequence Data:
  Insert Sequence

  >SC202553 3'UTR clone of NM_002150
  The sequence shown below is from the reference sequence of NM_002150. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTCACCAACATGGAGACCAATGGGGTGGTGCCCGGCATGTAAGCCCCGCCCACCCCACGGAGGCCACA
  GCCACACAGCCACGCCCCCTGATTCTGGAACTCGCCCAACTTCCCTACTGGCTGCTCCCCTTGGGTCCCG
  CCCACCAGCGGACTCGGCCCCCAAGGCTCCGCCCACACTGACCACGCCCCTCGGCGGGGCCGCCCTCTGC
  TCCAGCCCTCCCGATTAAAGCGTGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002150.2
• Summary: 'The protein encoded by this gene is an enzyme in the catabolic pathway of tyrosine. The encoded protein catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate. Defects in this gene are a cause of tyrosinemia type 3 (TYRO3) and hawkinsinuria (HAWK). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]'
• Locus ID: 3242