DDR2 (NM_001014796) Human 3' UTR Clone

CAT#: SC202563

3`UTR clone of discoidin domain receptor tyrosine kinase 2 (DDR2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DDR2
• Synonyms: MIG20a; NTRKR3; TKT; TYRO10; WRCN
• ACCN: NM_001014796
• Insert Size: 248 bp
• Sequence Data:
  Insert Sequence

  >SC202563 3'UTR clone of NM_001014796
  The sequence shown below is from the reference sequence of NM_001014796. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAATCCACCTTCTGCTCCTTCAACAAGGCGACGAGTGATGCTGTCAGTGCCTGGCCATGTTCCTACGGC
  TCAGGTCCTCCCTACAAGACCTACCACTCACCCATGCCTATGCCACTCCATCTGGACATTTAATGAAACT
  GAGAGACAGAGGCTTGTTTGCTTTGCCCTCTTTTCCTGGTCACCCCCACTCCCTACCCCTGACTCATATA
  TACTTTTTTTTTTTTTTACATTAAAGAACTAAAAAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001014796.1
• Summary: 'This gene encodes a member of the discoidin domain receptor subclass of the receptor tyrosine kinase (RTKs) protein family. RTKs play a key role in the communication of cells with their microenvironment. The encoded protein is a collagen-induced receptor that activates signal transduction pathways involved in cell adhesion, proliferation, and extracellular matrix remodeling. This protein is expressed in numerous cell types and may alos be involved in wound repair and regulate tumor growth and invasiveness. Mutations in this gene are the cause of short limb-hand type spondylometaepiphyseal dysplasia. [provided by RefSeq, Aug 2017]'
• Locus ID: 4921