SCFD1 (NM_016106) Human 3' UTR Clone

CAT#: SC202566

3`UTR clone of sec1 family domain containing 1 (SCFD1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SCFD1
• Synonyms: C14orf163; RA410; SLY1; SLY1P; STXBP1L2
• ACCN: NM_016106
• Insert Size: 211
• Sequence Data:
  Insert Sequence

  >SC202566 3'UTR clone of NM_016106
  The sequence shown below is from the reference sequence of NM_016106. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAGTTGTCACAACTTGGACAAAAGTAACACAGAAGAACCTTACTATGATAATCTACTTGGAATGTGGAT
  AAATGTAAAAAGAAGAAAAGTTAGAAGAGCAATATGTTTCCTTCTCTGTAACAGTGTCCTAACAGTGAAA
  ATCAGAGTTATTTGTTAATTTTTAAGGAAATTATATACTTAATATGTATTGATTAAAAGAAACATTTCAG
  A
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016106.2
• Summary: Plays a role in SNARE-pin assembly and Golgi-to-ER retrograde transport via its interaction with COG4. Involved in vesicular transport between the endoplasmic reticulum and the Golgi. [UniProtKB/Swiss-Prot Function]
• Locus ID: 23256