ZNRD1 (NM_014596) Human 3' UTR Clone

CAT#: SC202576

3`UTR clone of zinc ribbon domain containing 1 (ZNRD1) transcript variant b for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNRD1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ZNRD1
Synonyms HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZR14
ACCN NM_014596
Insert Size 215
Sequence Data
>SC202576 3'UTR clone of NM_014596
The sequence shown below is from the reference sequence of NM_014596. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAAGTTCCAGGAGAAGGAAGACTCTTGACCTTTTTCCTGGGCAACTCTACAGTCCCTCCCTCCTTTCGG
AAGGTGAAGGATACTGGGTTTTTAGATGCCTTGTCCATCCTGTCTGGTTGCAATGTTTTGCTCCCAGAAG
AGAATCAGATCATCATGTGGGGATTACCATTGTTCCTGGAGTACTCCTACCCTTAGTTGAATTTCCTTAT
TAAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014596.4
Summary This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 30834

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.