Acid Phosphatase (ACP1) (NM_001040649) Human 3' UTR Clone

CAT#: SC202617

3`UTR clone of acid phosphatase 1 soluble (ACP1) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACP1
• Synonyms: HAAP; LMW-PTP; LMWPTP
• ACCN: NM_001040649
• Insert Size: 265 bp
• Sequence Data:
  Insert Sequence

  >SC202617 3'UTR clone of NM_001040649
  The sequence shown below is from the reference sequence of NM_001040649. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTCTGACTGGAACGTGGGCCGGTCCCCAGACCCAAGAGCTGTGAGCTGCCTAAGAAATCATGGCATTC
  ACACAGCCCATAAAGCAAGACAGGTAGACAAGCTCTTGTTCAATTTCTAATATATAGAGTCCAGTAACTT
  GAGAAGTAGCGAAAGGATTAACCAGACTTGTATATTAATGAATGTGTTTATTTAGGGTGAGCTTAACCAG
  CTATGGTGTGTCCATTTTGTTTCACTTCTGGTTGCACGGTGTTGAAAGACTTGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001040649.2
• Summary: 'The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]'
• Locus ID: 52