ABL2 (NM_001136001) Human 3' UTR Clone

CAT#: SC202641

3`UTR clone of v-abl Abelson murine leukemia viral oncogene homolog 2 (arg Abelson-related gene) (ABL2) transcript variant e for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABL2
• Synonyms: ABLL; ARG
• ACCN: NM_001136001
• Insert Size: 238 bp
• Sequence Data:
  Insert Sequence

  >SC202641 3'UTR clone of NM_001136001
  The sequence shown below is from the reference sequence of NM_001136001. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATTGTGCCAATCAGACGTGCATAACATTGTGAACCAAAAGACACAGAGCAGGATGATGCTAGCAACGTA
  TTCATAGTAACTCCAAACTGGAAACAACCTAAACATCCATCAAGAGGAGAACAGGTGGATTGTGGTATAT
  TCACACGTTGGCATGCTACACAGCAATGAGAACCCCTGCCACATGCAGCAGCGTGGACGAATCTACACAC
  ATGATACTGGGCGAAAGAAGCCAGACAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001136001.1
• Summary: 'This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]'
• Locus ID: 27