TARS2 (NM_025150) Human 3' UTR Clone

CAT#: SC202675

3`UTR clone of threonyl-tRNA synthetase 2 mitochondrial (putative) (TARS2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TARS2
• Synonyms: COXPD21; TARSL1; thrRS
• ACCN: NM_025150
• Insert Size: 243
• Sequence Data:
  Insert Sequence

  >SC202675 3'UTR clone of NM_025150
  The sequence shown below is from the reference sequence of NM_025150. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGCTACAGAACACGAGGGTCCCAAATGCCGAAGAAATTTTCTGAGCCTTTGTACATAGATGAGGCAA
  AAACCTGCGAGTGCCATCAGCCTCCCTCACATGGGAGACCCCAACCCAGCTGACAATGTGGAGCCCCCAG
  AACTTCAGAACTGTGTGGAGGCACATGTCTGCTCTCCTGAAAAGAGACTTGGTTTGGGGACCCCACAAAA
  GGAGGGAAGCTGTAGCTGTTTGGATGTGAGGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_025150.3
• Summary: This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
• Locus ID: 80222