ALDH1L1 (NM_012190) Human 3' UTR Clone

CAT#: SC202676

3`UTR clone of aldehyde dehydrogenase 1 family member L1 (ALDH1L1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALDH1L1
• Synonyms: 10-fTHF; 10-FTHFDH; FDH; FTHFD
• ACCN: NM_012190
• Insert Size: 273
• Sequence Data:
  Insert Sequence

  >SC202676 3'UTR clone of NM_012190
  The sequence shown below is from the reference sequence of NM_012190. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCTGAACGAGTACCTGCGGGTCAAGACAGTGACCTTCGAATACTGAAGAAAGGTCTTTGTGAGAAGAAA
  GTCCCTGCCCCTCCCTCGTGGCTGGGGCCCCCTCCCTCTTGAGCCTGGGTGCACAGCACCTCCCACCTGG
  GGGGCTAGTGGAAGCCCTCCTGCCTGCACACCATGTCTGCATCTTGGACGCCCTCTGTCCAGTCAGAAGC
  AGCCCTTGGCTGGGTGAGGTGTGCCCCTCCCAGGGAGAATAAAGCTTCTGAAGAGAGACCGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_012190.2
• Summary: The protein encoded by this gene catalyzes the conversion of 10-formyltetrahydrofolate, nicotinamide adenine dinucleotide phosphate (NADP+), and water to tetrahydrofolate, NADPH, and carbon dioxide. The encoded protein belongs to the aldehyde dehydrogenase family. Loss of function or expression of this gene is associated with decreased apoptosis, increased cell motility, and cancer progression. There is an antisense transcript that overlaps on the opposite strand with this gene locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
• Locus ID: 10840