KCNK15 (NM_022358) Human 3' UTR Clone

CAT#: SC202720

3`UTR clone of potassium channel subfamily K member 15 (KCNK15) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNK15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNK15
Synonyms dJ781B1.1; K2p15.1; KCNK11; KCNK14; KT3.3; TASK-5; TASK5
ACCN NM_022358
Insert Size 179
Sequence Data
>SC202720 3'UTR clone of NM_022358
The sequence shown below is from the reference sequence of NM_022358. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGGTGGAAGTCCATCTGACAACCCCACCCAGGCCAGGGTCGAATCTGGAATGGGAGGGTCTGGCTTCAGC
TATCAGGGCACCCTCCCCAGGGATTGGAAACGGATGACGGGCCTCTAGGCGGTCTTCTGCCACGAGCAGT
TTCTCATTACTGTCTGTGGCTAAGTCCCCTCCCTCCTTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022358.2
Summary This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
Locus ID 60598

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.