Epoxide hydrolase (EPHX1) (NM_000120) Human 3' UTR Clone

CAT#: SC202753

3`UTR clone of epoxide hydrolase 1 microsomal (xenobiotic) (EPHX1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPHX1
• Synonyms: EPHX; EPOX; HYL1; MEH
• ACCN: NM_000120
• Insert Size: 221 bp
• Sequence Data:
  Insert Sequence

  >SC202753 3'UTR clone of NM_000120
  The sequence shown below is from the reference sequence of NM_000120. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACATCCGCAAGTTCCTGTCGGTGCTGGAGCGGCAATGACCCACCCCTCTCCCCCCGCCTGCCACCTCCCC
  CCACAAGTGCCCTCCAGGCTTTTCTTGGGGAAGATACCCCTTTTCTGAGGAATGAGTTTGCCTCCGTCCC
  CTGCCCATGCTGGGAGCCCACGCTCACCCCCTCACCCCTCCAAGCTCACTCCCCAACCCCCAACTCCGTG
  TGGTAAGCAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000120.3
• Summary: 'Epoxide hydrolase is a critical biotransformation enzyme that converts epoxides from the degradation of aromatic compounds to trans-dihydrodiols which can be conjugated and excreted from the body. Epoxide hydrolase functions in both the activation and detoxification of epoxides. Mutations in this gene cause preeclampsia, epoxide hydrolase deficiency or increased epoxide hydrolase activity. Alternatively spliced transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2008]'
• Locus ID: 2052