CD130 (IL6ST) (NM_002184) Human 3' UTR Clone

CAT#: SC202754

3`UTR clone of interleukin 6 signal transducer (gp130 oncostatin M receptor) (IL6ST) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL6ST
• Synonyms: CD130; CDW130; GP130; IL-6RB
• ACCN: NM_002184
• Insert Size: 232 bp
• Sequence Data:
  Insert Sequence

  >SC202754 3'UTR clone of NM_002184
  The sequence shown below is from the reference sequence of NM_002184. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACCACAGACTGTACGGCAAGGCGGCTACATGCCTCAGTGAAGGACTAGTAGTTCCTGCTACAACTTCAG
  CAGTACCTATAAAGTAAAGCTAAAATGATTTTATCTGTGAATTCAGATTTTAAAAAGTCTTCACTCTCTG
  AAGATGATCATTTGCCCTTAAGGACAAAAATGAACTGAAGTTTCACATGAGCTATTTCCATTCCAGAATA
  TCTGGGATTCTACTTTAAGCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002184.2
• Summary: 'The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014]'
• Locus ID: 3572