Retinoid X Receptor gamma (RXRG) (NM_001009598) Human 3' UTR Clone

CAT#: SC202758

3`UTR clone of retinoid X receptor gamma (RXRG) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "RXRG"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol RXRG
Synonyms NR2B3; RXRC
ACCN NM_001009598
Insert Size 227
Sequence Data
>SC202758 3'UTR clone of NM_001009598
The sequence shown below is from the reference sequence of NM_001009598. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAACTTCTGCTCTCCACATCGCTAGGGCTGTGAAAACAGATACTGTGAGCCCTGAACCCTCCAGGAGGC
TGCTTCCCCATGACACTAGTGACCAGTAAAATGAAAAGGAGGAGCAAAGGAGATTTTGAGTCACAGAAAT
GAAACCCAGGCAACCAGCCTAGAAGAAACACTCCAAGATATTCATTAAGTGCTTTGTTTCCCGTTCCTCT
GACATCTTGTAAATGCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001009598.1
Summary This gene encodes a member of the retinoid X receptor (RXR) family of nuclear receptors which are involved in mediating the antiproliferative effects of retinoic acid (RA). This receptor forms dimers with the retinoic acid, thyroid hormone, and vitamin D receptors, increasing both DNA binding and transcriptional function on their respective response elements. This gene is expressed at significantly lower levels in non-small cell lung cancer cells. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2010]
Locus ID 6258

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.