ACYP1 (NM_001107) Human 3' UTR Clone

CAT#: SC202778

3`UTR clone of acylphosphatase 1 erythrocyte (common) type (ACYP1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACYP1
• Synonyms: ACYPE
• ACCN: NM_001107
• Insert Size: 247
• Sequence Data:
  Insert Sequence

  >SC202778 3'UTR clone of NM_001107
  The sequence shown below is from the reference sequence of NM_001107. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTGGATTACTCAGACTTCCAAATTGTAAAATAATGGCCTGAATTTAAGTTTTCTAAGATAAACTCAGTG
  GTTTGGTTTTTATTATTAATAGAGATAGAACTATTGTGTGTTAATATTAGCATTAGTCAATAAGTTATTT
  TAATGTCAGATTTTTGAATGTTATTATATATTACCTGTATGATGGAAGGATTACCACTGTACACAAATCT
  AATCAATAAAAACGTTAGAACCTTCTGCTTAGAGTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001107.3
• Summary: This gene is a member of the acylphosphatase family. The encoded protein is a small cytosolic enzyme that catalyzes the hydrolysis of the carboxyl-phosphate bond of acylphosphates. Two isoenzymes have been isolated and described based on their tissue localization: erythrocyte (common) type acylphosphatase encoded by this gene, and muscle type acylphosphatase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
• Locus ID: 97